Biological Control for Solanum melongena L.in Sustainable Agriculture.

The environment and ecosystem were disrupted by the extensive use of fertilizers and pesticides which are harmful to humans and animals. Nature unfolds a biological response to overcome the different types of hazardous agrochemicals, in the form of microorganisms which have the efficiency to encourage plant growth without disturbing the environment. We conducted a biological approach to control phytopathogenic agents by plant growth-promoting rhizobacteria (PGPR), capable of restraining the devastation by phytopathogen. Pseudomonads can cling to soil particles, motile, prototrophic, and antibiotic synthesis along with the production of hydrolytic enzymes. Pseudomonas fluorescens extracted from the soils of Kerala were subjected to the identification of genes that have the phytostumillatory effect. These bacteria were immobilized using sodium alginate beads and applied to the soil where Solanum melongena (L.) was planted and the growth was compared with plants treated with cyanobacteria Spirulina platensis and NPK. The plants treated with PGPR showed high potential in growth-promoting characters when compared to cyanobacteria and NPK. P. fluorescens is an intense bio-agent to use in the field of agriculture because of its multifaceted utility.

Introduction

Agriculture output must increase by 50% to support the world’s nine billion people, whose population is rapidly expanding¹by 2050. Leaving aside any potential compensation from rising levels of carbon dioxide (Co₂), 17% is the agricultural output in response to climate.²⁰ Climate change not only lowers crop yield but raises the price of agricultural products, raising the likelihood of 77 million people experiencing food poverty by 2050.¹¹ The objective is to improve soil health by sequestering soil carbon and mitigate harsh climatic circumstances²⁴ by increasing the production of nutritious food while decreasing unsustainable inputs. Sustainable practices and adopting environmentally friendly technology can help break this feed-forward loop in such a scenario by enhancing production under a variety of more harsh environmental conditions and improving resource usage efficiency.⁸ The plant-influenced areas with the highest levels of microbial diversity²⁸ are roots, root surfaces, and cellular space in between plant cells; these areas are known as the rhizosphere, rhizoplane, and endosphere; they are essential for carbon sequestration and phytoremediation.^8,6Given that microbial abundance can influence greenhouse gas emissions, the composition of the bacterial community is significantly associated with soil features across the ecosystem.⁹ Furthermore, through their metabolic activities, the bacteria in the rhizosphere contribute significantly to the practical cycling of carbon between the soil and the atmosphere.³

Microbial abundance and diversity in rhizosphere are influenced by host plants and soil characteristics.²⁶ Recently, the signal exchange part of this synergistic interaction has come into prominence. The quantity and behavior of plant-associated bacteria are influenced by root exudates, which contain organic acids, sugar, vitamins, and other compounds.¹⁰ According to,²² microbe-to-plant signals are necessary for the growth of host plants. Chemical fertilizers can be excluded by using phytomicrobiomes (microbial inoculation and signal exogenous administration) which produce a higher, robust and sustainable agricultural manufacturings.

Brinjal or Eggplant (Solanum melongena L.), a member of the Solanaceae family, is cultivated around the world in subtropical and tropical climates. One of the most widespread, productive, and well-liked vegetable crops in India. It has a good reputation as a poor man’s crop. In India and China, the unripe fruit of the aubergine is predominantly used as a daily kitchen vegetables for numerous meals. There are claims that brinjal has therapeutic qualities against disturbances and diseases like gastro intestinal problems, Skin related irritations, dental aches and hemorrhoids are treated by using various plant components. The secondary production of brinjal is by India preceding by China. The estimated volume of production according to the year 2023 is 12.61 million metric tons. 760 thousand hectares of agricultural land were utilized for the production. In Odisha, the production of brinjal is 2,128.52 tons/ha. Since it is widely held that brinjal is not a particularly for health benifits. However, it is comparable to tomatoes in terms of nutritional value and is relatively high. For greater growth, fruit, and seed yield, solanaceous vegetables often need substantial quantities of the secondary minerals calcium and sulfur, as well as the key nutrients nitrogen, phosphorus, and potassium. The price of inorganic fertilizer has been skyrocketing, making it unaffordable for small and marginal farms while also continuously degrading the ecological Raghvendra niche.²⁷ Application of biofertilizers can increase soil biological activity, a key indicator of soil fertility.³⁰ The present investigation was designed to determine a class of helpful bacteria called plant growth-promoting rhizobacteria (PGPR) that may hydrolyze both organic and inorganic phosphorus from insoluble substances. Pseudomonas fluorescens is advantageous and cost-effective for crop productivity, quality, yield, and growth.

Materials and Methods

Rhizospheric Site and Bacterial Isolation

Healthy vegetable plant rhizosphere soil samples were gathered from several sites in Kerala, India. We used the conventional serial dilution method to isolate the microorganisms. One gram of soil from the root portion was appropriately cleaned out and added to 9 mL of sterile physiological saline Himedia (pH 7.2), vortexed for 10 minutes, and left to rest for 20 minutes. A 100µl aliquot of each successively diluted soil suspension was then distributed onto the surface of nutrient agar plates and cultured for two to three days at 30 ± 2°C. To obtain pure colonies, distinct colonies were chosen, subcultured on a nutrient agar plate, Himedia, and then preserved in 20% glycerol solutions at -20°C. For additional research, P. fluorescens isolates with distinctive colony shapes were chosen.

Genomic DNA Isolation of P. fluorescens by Phenol Chloroform method

The chosen isolates underwent an overnight culture, were centrifuged for 10 minutes at 13,000 rpm, and the supernatant was disposed of carefully. Two additions were made: twenty microliters of proteinase K (50 micrograms per millilitre) and two millilitres of cell lysis buffer, all vortexed. The tubes were kept in a water bath at 55°C for fifteen minutes (microtubes were fixed with parafilm; Samarath Electronics, India). After adding 220 µl of PCI solution (saturated phenol, chloroform, and isoamyl alcohol; 25:24:1), the tubes were rolled between the palms to combine the mixture. After 15 minutes of centrifuging the tubes at 13,000 rpm, the top layer was removed and placed in fresh microtubes. Once more, 220 µl of PCI solution was added, and centrifugation was repeated briefly at 13,000 rpm for fifteen minutes. A fresh microtube was used to collect the top layer. A comparable dosage of chloroform was applied to the top layer. After 15 minutes of centrifuging the tubes at 13,000 rpm, the fluid stage was collected and transferred to fresh microtubes. Included was a two-fold amount of cooled absolute alcohol, which was kept overnight in a refrigerator set at -20 °C (1-2 hours). The tubes were centrifuged for 20 minutes at 13,000 rpm to get a DNA pellet, and the supernatant was discarded. The pellet obtained following centrifugation at 13,000 rpm for 10 minutes was washed with 300 µl of extremely cold 70% alcohol. After laboriously pouring off the ethanol, it was dried in an incubator at 37°C for 30 to 45 minutes (Microsil, India). After adding 50 µl of hydration buffer (1x MilliQ TE), it was allowed to rehydrate at room temperature for ten minutes before being stored in a 4°C refrigerator. Electrophoresis by 0.8% agarose gel was done to measure and examine the amount and quality of DNA in Lab India Analytical’s spectrophotometric analysis.

Primer Designing/Synthesis

Using the Primer-BLAST tool offered by NCBI with these sequences as targets, primers were created. BLAST analysis was used to evaluate the specificity of the primers. Eurofins Genomics, based in Bangalore, India, creates custom-designed primers. The sequence data thus obtained was further subjected to BLAST analysis.

Table 1: Primers used for PCR analysis along with their annealing temperatures

Gene	sequence		Annealing temperature (°C)	Time
Pyoluteorin (plt)	plt-F	5‟ – CAACGGCTGTTGCTGATG -3‟	56°C	40 sec
	plt-R	5‟- GTGCCCGATATTGGTCTTGA-3‟
ACC Deaminase Gene	ACC-F	5′- GTTATCCATTGACCTTCGGTCCT -3′	59°C	40 sec
	ACC-R	3′ – TTCGTTGGGCAAGCCATATT – 5′

Effect of P. fluorescens & S. platensis on growth parameters of S. melongena L.

Seed Inoculation

A pure culture of P. fluorescens was cultured in NB broth for inoculating seeds. Before being washed ten times in sterile water, the seeds were surface sterilized for ten minutes in 1.2% sodium hypochlorite and two minutes in 70% ethanol. Afterwards, the seeds were kept sterile and exposed to the bacterial solutions for 30 minutes.

Immobilization using sodium alginate beads

A loop of culture was added to 200mL of LB broth Himedia to create the microbial culture, which was then cultured for one day at 28°C. Then, 4 g of sodium alginate Himedia was dissolved in 100 mL of distilled water while being continuously stirred at 60°C for one hour to create 4% sodium alginate. Microbial culture was combined in a 1:2 ratio with sodium alginate. It was then dipped into a 0.2M calcium chloride solution to create sodium alginate beads that contained the microbial cell. The beads were left to harden for 30 minutes. Then, three beads were put around each plantlet.

Effect of P. fluorescens & S. platensis. on the growth of S. melongena L.

With four treatments, three replications, and dispersed pots in the following configurations, the experiment was fully randomised: T1; soil with seeds of S. melongena (control), T2; soil with seeds added with NPK fertilizer (100%), T3; seeds and soil with P. fluorescence administered in the form of immobilized cells (100%), and T4; seeds and soil with S. platensis, a cyanobacteria (100%). Plants were carefully removed from the pots after maturation and biometric measurements such as root length, shoot length, fresh weight, fruit weight, number of fruits, dry weight, and fresh/dry weights of the plant were recorded.

Statistical Analysis

The variability in impact of various treatments and control condition on parameters like shoot length, root length, total length, wet weight, dry weight, (wet – dry) weight, number of leaves was statistically analysed using R version 4.0. All statistical analysis was conducted at 95% level of significance. Normally distributed variables were assessed using parametric test like ANOVA supplemented with TUKEY HSD post-hoc test. Non-normal variables were analysed using non-parametric equivalent of ANOVA like Kruskal Wallis test supplemented with a post-hoc analysis. All assumptions were checked on the variables prior the ANOVA test.

Result

Plant growth-promoting rhizobacteria (PGPR): Isolation and Screening

From different rhizospheric soils strains of rhizobacteria were purified, after being isolated and were then tested for various traits that promote plant growth (PGP). P6- Fa- were discovered to be very positive during the screening for IAA formation. For sample Fa, BLAST analysis showed a 100% similarity with P. fluorescens (NCBI Accession No: MN173420.1) with a query coverage of 100.

Figure 1: Pseudomonas fluorescens

MenuMenu

Biological Control for Solanum melongena L. in Sustainable Agriculture.

You may also like...

Study of Allelopathic Effects of Argemone mexicana L. Root Extract on Seed Germination and Growth of Triticum aestivum L. under in vitro Condition

Assessment of Physical and Biochemical Qualities of Solanum tuberosum L. Under Roadside Traffic Polluted Area

Exploring the Potential and Prospects of Underutilized Vegetables- A Review

**Study of Allelopathic Effects of Argemone mexicana L. Root Extract on Seed Germination and Growth of Triticum aestivum L. under in vitro Condition**